Soaking RNAi / Preparation of dsRNA
May, 2003
N.Uodome /A. Sugimoto
Laboratory of Developmental Genomics
RIKEN Center for Developmental Biology
1. PCR
yk cDNA clones (yk001-yk699) are cloned into lamdaZAP II, which can be converted to pBluescirpt plasmid by in vivo excision. The cloning site of pBluescript contains T7 and T3 RNA polymerase recognition sites at each side. This PCR reaction will convert the T3 promoter site into T7 site, so that both RNA strands can be synthesized in one reaction by T7 RNA polymerase.
PCR Mixture
| Final conc. |
For 1 sample |
|
| 10x buffer |
1 x |
3 uL |
| T7 Primer (f, 10uM) |
0.2 uM |
0.6 uL |
| Cmo422 Primer (r, 10uM ) |
0.2 uM |
0.6 uL |
| dNTPs (2.5mM each) |
200 uM |
2.4 uL |
| Ex Taq ( 5 U/uL) |
0.025 U/uL |
0.15 uL(0.75U) |
| Sterilized Water |
18.3 uL |
|
| (Template) |
(5uL, 10-100 ng) |
|
| (Total volumn) |
(30 uL) |
---Ex Taq : Takara (#RR001C) 10x buffer and dNTPs are supplemented.
---Both primers contain the T7 polymerase recognition site.
( forward ) : ÒT7Ó 5Õ – GTAATACGACTCACTATAGGGC – 3Õ
( reverse ): ÒCmo422Ó 5Õ – GCGTAATACGACTCACTATAGGGAACAAAAGCTGGAGCT – 3Õ
The underline shows the minimum promoter sequence needed for efficient transcription.
Note: For the more recent yk clones (yk700-), pME18S-FL3 vector is used, which do not have T3/T7 promoter sequence. To add T7 promoter sites for these clones, use the following PCR primers.
T7ME774FW: 5'-TAA TAC GAC TCA CTA TAG GGC TTC TGC TCT AAA AGC TGC G
T7-ME1250RV: 5'-TAA TAC GAC TCA CTA TAG GGT GTG GGA GGT TTT TTC TCT A
Program :
( 94C x 1Õ )
( 94C x 1Õ, 55C x 30Ó, 72C x 2Õ 30Ó ) x 30 cycle
( 4C x °)
This PCR reaction produce about 0.4 ug/uL DNA fragment.
Keep 1 uL Sample with 9 uL DNA Loading Buffer ( as follows ) at -30C for the electrophoresis check later.
DNA Loading Buffer ( for 1 uL DNA Sample )
| Final conc. |
For 1 Sample |
For Stock |
|
| Takara 10x Loading Dye |
X 1 |
1 uL |
11 mL |
| H2O |
8 uL |
88 mL |
The aliquots of this buffer are straged at -30C.
2. RNA Transcription
Prepare the following mixture in the 2mL tube.
RNA Transcripiton Mixture
| Final concentration. |
For 1 Sample |
|
| 10 x Buffer |
1 x |
10 uL |
| NTPs (25mM, each) |
250 uM |
1 uL |
| Thermo T7 polymerase(50U/uL) |
1 U / uL |
2 uL (100 U) |
| Sterilized water |
80 uL |
|
| Template (DNA fragment) |
(7 uL, about 2.8 ug) |
|
| (Total volume) |
(100 uL) |
Thermo T7 polymerase : TOYOBO ( #TRL-201 ) x 10 buffer is supplemented.
NTPs : Amersham Bioscience ( #27-2025-01 ) Each 100mM nucleotide were mixed equivalently and
this aliquots are straged at -30.
Reaction condition : 37C x 90 min.
The sense and antisense RNA are transcribed from the PCR product in one tube. Annealing reaction is unnecessary.
This reaction synthesizes about 0.4 ug /uL RNA, total yield is about 40 ug by measurement OD 260.
3. DNase Ⅰ Treatment
Digest the template DNA by DNase 1.
Add 1 uL DNase 1 directly into the reaction tube.
DNase Ⅰ: ( Takara, #2216B )
Reaction condition : 37C x 20 min.
4. Purification of RNA
This procedure remove proteins and nucleotides.
Use ÒWizard Plus SV Miniprep Spin ColumnÓ (Promega) in the following kit. The membrane of one column can bind max. 130 ug RNA and 40 ug DNA.
(Wizard Plus SV Minipreps DNA Purification System, Promega #A-1460)
DonÕt use the contained solutions ( for lysis of E.coli ) in this kit except Wash Solution.
Prepare RNA Denaturing Solution and store at room temperature.《4 M Guanidine Thiocyanate, 0.01M Tris/HCl (pH 7.5)》or 《0.01M Tris/HCl (pH 7.5)》
1) Add 700 uL RNA Denaturing Solution into 100 uL transcribed RNA and mix well.
2) Add 800 uL ethanol and mix well.
3) Put 800 uL of the mixture into Spin column with Collection tube , centrifuge at 15,000 rpm for 1 min.
Discard the solution of Collection tube.
( Caution : This solution cantains Guanidine Thioocyanate, it is harmful. DonÕt thraw it into the sink. )
4) Put the remaining 800 uL mixture into the same Spin column, centrifuge at 15,000 rpm for 1 min.
Discard the solution of Collection tube.
5) Put 800 uL Wash Solution into Spin column, centrifuge at 15,000 rpm for 1 min.
Discard the solution of Collection tube.
6) Put 400 uL Wash Solution into Spin column, centrifuge at 15,000 rpm for 3 min.
Transfer Spin column to new 1.5 mL tube. Add 100 uL Sterilized Water and wait for 5 min.
7) Centrifuge at 15,000 rpm for 3 min.
Approx. 100 uL RNA solution is eluted, this concentration is about 0.15 - 0.2 ug/uL and total yield is about 15 - 20 ug.
Alternative protocol:
To remove the proteins, Phenol, Phenol/chloroform, Chloroform extraction can be used.
We feel that proteins remaining in the RNA solution sometimes inhibit the RNAi reaction. So repeat Phenol/chloroform extraction when necessary.
5. Concentration
Concentrate RNA sample using the rotary evaporator. Stop the concentration before appearing the viscous matter. 0.5 – 1 ug/uL RNA is suitable for RNAi soaking. Excessive concentration can be harmful for the worms.
Alternative protocol:
For concentration, you can use isopropanol precipitation.
Add 1/10 vol. of 3M Sodium Acetate & Equal vol. of isopropanol, and centrifuge.
Rince with 70% ethanol. Suspend with 20uL of Water.
6. Check of RNA
Check the integrity of dsRNA using either one of the following methods.
6-1) Agarose Gel Electrophoresis
Run DNA and dsRNA samples on a 1 % agarose gel to examine their size.
( Caution : Ethidium Bromide is harmful. DonÕt thraw it into the sink. )
RNA Sample Preparation
Mix 1 uL RNA with DNA Loading Buffer as same as DNA sample. ( ref. 1 ).
Agarose Gel Preparation
Native Gel (1 %)
| composition |
Running Buffer |
|
| Agarose |
1 % |
1 x TAE with 0.5ug/mL Ethidium Bromide |
| 1 x TAE |
As the tray size |
|
| Ethidium Bromide (10mg /mL) |
1/20,000 vol. |
Agarose : nacalai tesque #01132-34
TAE Buffer : 40 mM Tris, 40 mM Acetic Acid, 1 mM EDTA ( pH 7.0 )
Dissolve agarose in TAE buffer using a microwave oven with intermittent swirling. Leave to cool to 65 C. Add Ethidium Bromide. Pour it into the gel tray. Place the comb.
Arrange DNA sample at left lane and RNA sample at right lane, run with the DNA marker (See 8-3 ). Take a photo of the gel using UV transilluminator.. DNA and dsRNA will be similar mobility in the gel. If single stranded RNA ( not annealed ) is present, it will run faster than these.
6-2) Denaturing Agarose Gel Electrophoresis
By using Denaturing gel, RNA band will be sharper than the native gel.
RNA Sample Preparation
Mix 1 uL RNA with 9 uL RNA Loading Buffer ( as follows ). Denature at 65 C for 15 min. and put sample on the ice immediately.
RNA Loading Buffer ( for 1 uL Sample )
| Final conc. |
For 1 Sample |
For Stock |
|
| Formamid |
50% |
5 uL |
55 mL |
| Formaldehyde |
18% |
1.8 uL |
19.8 mL |
| 20 xMOPS |
1 x |
0.5 uL |
5.5 mL |
| Glycerol |
8% |
0.8 uL |
8.8 mL |
| 500mM EDTA |
0.16 mM |
0.0032 uL |
35.2 uL |
| BPB |
approx. |
approx. |
|
| Sample |
1 uL |
||
| Ethidium Bromide (10mg /mL) |
10 ug/mL |
1.1 mL |
|
| Total Vol. |
(10 uL) |
The aliquots of this buffer are straged at -30C.
Agarose Gel Preparation
Denaturation Gel
| Tray A |
Tray B |
Running Buffer |
|||
| Agarose |
0.53 g |
0.8 g |
1 x MOPS |
||
| H2O |
40 mL |
60 mL |
|||
| 20 x MOPS |
2.2 mL |
3.3 mL |
|||
| Formaldehyde |
1.35 mL |
2.0 mL |
|||
| Ethidium Bromide (10mg /mL) |
2uL |
3uL |
|||
MOPS : 20 mM MOPS, 5mM Sodium Acetate, 1mM EDTA (pH 7.0)
Tray A : Mupid, Tray B : Nihon Eido
Dissolve agasose in water using a microwave oven with intermittent swirling, leave to cool to 65 C. Then add 20 x MOPS and formaldehyde. Run the RNA sample with a RNA marker (see 6-3 ). After running, transfer the gel to a clean tray with about 1 L H2O for removing formaldehyde, shake gently for 1 hour. Take a photo of the gel using UV transilluminator.
6-3) DNA and RNA Markers
for Native Gel Electrophoresis
500 bp DNA Ladder : Takara #3411B
for Denaturation Gel Electrophoresis
Perfect RNA Markers, 0.2 - 10 kbTakara #NV423
6-4) Mesurement Concentration of RNA
Quantitate the RNA sample by measuring its absorbance at 260 nm and calculating the concentration as follows:
1 Abs 260 = 40 ug RNA / mL
7. Aliquot RNA Sample for RNAi - Soaking
Transfer 8 uL RNA sample into 8 Thermo-Strip PCR tube (AB Gene, #AB-0266) or Thermo-Tube (AB Gene, #AB-0337) for RNAi – Soaking. And keep it at – 30 C until the day of the experiment. (X5 Soaking Buffer will be added to the RNA solution at the time of the experiment.)
RNAi-by-soaking
Naoko Sakumoto / Asako Sugimoto
RIKEN Center for Developmental Biology
May, 2003
L4 soaking
1. Monday evening
¯ Prepare 10ul dsRNA solution
Add 5x soaking buffer 2 ul to dsRNA 8 ul (See Òpreparation of dsRNAÓ)
5 x soaking buffer 1.25 x M9 (Mg2+ free)
15 mM spermidine (SIGMA S2626)
0.25 % gelatine
Store at -30C
¯ Soak four to six L4 larvae in dsRNA solution (Soaked worms are called as P0 worms)
¯ Keep soaking at 20C, 24hours
2. Tuesday Evening
¯ Recover the soaked worms on a plate with food ( E. coli was grown in the shape of ÒeÓ on 6cm NGM plate.) This is the plate 1.
¯ Record the number of the recovered P0 worms. (Max. 4 worms/plate)
¯ Incubate at 25C.
3. Wednesday Evening
¯ After 24 hours, transfer the P0 worms to a new plate with food. This is the plate 2.
¯ Observe the condition (sick or dead) of the P0 worms.
¯ Record the number of the P0 worms on the plate 2.
4．Thursday Morning
¯ Count the F1 embryos and Larvae on plate 1 (There must be no adult on the plate at this point).
5. Thursday Evening
¯ Transfer the P0 worms to a new plate (3cm) with food.
¯ Observe the condition (sick or dead) of the P0 worms.
6. Friday Morning
¯ Count the F1 embryos and Larvae on the plate 2 (There must be no adult on the plate at this point).
7． Friday Evening
¯ Observe the phenotypes of worms on the plate 1.
8．Saturday
¯ Observe the phenotypes of worms on the plate 2.
L1 soaking
1. 1st day
¯ Egg preparation ; Collect the adult worms in 10 ml tube. Mix with 1ml bleach solution (2:1:1 =1N NaOH : bleach NaClO : DW) and vortex for a few minutes. When worms are killed, add M9 buffer, and centrifuge to pellet eggs. Wash eggs with M9 buffer a few times. Eggs were transferred onto the plate without food to hatch overnight.
2. 2nd day
¯ Collect the L1 larvae on the plate and Prepare L1 larvae culture of 100 larvae/ 1ul.
¯ Prepare 10ul dsRNA solution
Add 5x soaking buffer 2 ul into dsRNA 8 ul
5 x soaking buffer 1.25 x M9 (Mg2+ free)
15 mM spermidine (SIGMA S2626)
0.25 % gelatine
Store at -30C
¯ Add 1ul L1 larvae culture into dsRNA solution.
¯ Keep soaking at 20C, 48 hours (or 24 hours).
4. 3rd day (or 4th day)
¯ Recover L1 larvae on a plate with food ( E. coli was grown e shape on 6cm NGM plate).
¯ Incubate at 25C
5. 4th day (or 5th day)
¯ Observe the growth of soaked worms (control worms are L3-L4).
¯ Count the number of worms in each stage.
6. 5th day (or 6th day)
¯ Observe the phenotype of soaked worm (control worms are adult).
¯ Count the number of worms in each stage.